circad | circRNAs associated with diseases

circMTO1/hsa_circRNA_0007874/hsa_circRNA_104135
Gene	MTO1	Organism	Human
Genome Locus	chr6:74175931-74176329:+	Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink	Link to database	PMID	28520103
Experimental Method
Sample Type	HepG2, SMMC-7721, QGY-7701 Cell lines and Tissues	Comparison	289 samples of HCC and paired adjacent liver tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGCATCAGAGGCTTGGAGAA Reverse AAGGAAGGGGTGATCTGACG	Statistics	Fold Change : Downregulated pvalue : p< 0.001
Citation
Han, D, Li, J, Wang, H, Su, X, Hou, J, Gu, Y, Qian, C, Lin, Y, Liu, X, Huang, M, Li, N, Zhou, W, Yu, Y, Cao, X (2017). Circular RNA circMTO1 acts as the sponge of microRNA-9 to suppress hepatocellular carcinoma progression. Hepatology, 66, 4:1151-1164.